Sequence ID | >W1711185964 |
Genome ID | LWNV01000017 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Corynebacterium sp. HMSC08C04 [LWNV] |
Start position on genome | 29337 |
End posion on genome | 29247 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
cctagaccac |
tRNA gene sequence |
GGTGGCGTGTCCGAGCGGCCGAAGGTGTTCGCCTCGAAAGCGAATGTTGGGTAACCCCCA |
Downstream region at tRNA end position |
tagcgaaagc |
Secondary structure (Cloverleaf model) | >W1711185964 Ser CGA c GCCA tagcgaaagc G - C G - C T - A G - C G - C C - G G - C T A T C G C C C A C G A G | | | | | A G G C C T G C G G G C G | | T T C A G G T C G A G TGTTGGGTAACCCCCAACC T - A T - A C - G G - C C - G C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |