Sequence ID | >W1711187903 |
Genome ID | LWPW01000082 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Corynebacterium sp. HMSC074C04 [LWPW] |
Start position on genome | 8725 |
End posion on genome | 8643 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
ttcgcgacgg |
tRNA gene sequence |
GCGCCTGTGGCGGAATTGGCAGACGCGCTGGATTTAGGTTCCAGTGCCTTAGGGCGTGGG |
Downstream region at tRNA end position |
ataaataccc |
Secondary structure (Cloverleaf model) | >W1711187903 Leu TAG g ACac ataaataccc G - C C - G G - C C - G C - G T - A G - C T G T C C C T C A T A A G | | | | | G T G G C G G G G A G C G | | | T T G A C G C C A G G TGCCTTAGGGCGT C - G T - A G - C G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |