Sequence ID | >W1711190231 |
Genome ID | LWRY01000015 |
Search identical group | |
Phylum/Class | Acidithiobacillia |
Species | Acidithiobacillus thiooxidans [LWRY] |
Start position on genome | 17211 |
End posion on genome | 17135 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
tctgcagcac |
tRNA gene sequence |
GCGCAGTTAGCTCAGCTGGATAGAGTGTCGGCCTCCGAAGCCGAAGGTCACTGGTTCGAA |
Downstream region at tRNA end position |
tattcattca |
Secondary structure (Cloverleaf model) | >W1711190231 Arg CCG c ACCA tattcattca G - C C - G G - C C - G A - T G - C T - A T A T T G A C C A C G A A | | | | | G T C T C G A C T G G C G | | | + T T G G A G T A T A G AGGTC T - A C - G G - C G - C C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |