| Sequence ID | >W1711190268 |
| Genome ID | LWRY01000146 |
| Phylum/Class | Acidithiobacillia |
| Species | Acidithiobacillus thiooxidans [LWRY] |
| Start position on genome | 6523 |
| End posion on genome | 6598 |
| Amino Acid | Arg |
| Anticodon | CCT |
| Upstream region at tRNA start position |
ctggacccat |
| tRNA gene sequence |
GCCCCGGTAGCTCAGTGGATAGAGCAACCGCCTCCTAAGCGGTAGGTCGCGCGTTCGATT |
| Downstream region at tRNA end position |
tataaaacaa |
| Secondary structure (Cloverleaf model) | >W1711190268 Arg CCT
t ACCA tataaaacaa
G - C
C - G
C - G
C - G
C - G
G - C
G + T T T
T C G C G C A
T G A A | | | | | G
G C T C G G C G C G C
G | | | | T T
A G A G C
T A A AGGTC
A - T
C - G
C - G
G - C
C - G
C A
T A
C C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |