Sequence ID | >W1711190269 |
Genome ID | LWRY01000155 |
Search identical group | |
Phylum/Class | Acidithiobacillia |
Species | Acidithiobacillus thiooxidans [LWRY] |
Start position on genome | 7889 |
End posion on genome | 7814 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
gcttttacat |
tRNA gene sequence |
GCCGGCATAGCTCAATTGGTAGAGCGCCTGCCTCCAAAGCAGGATGTTCGCGGTTCGAGT |
Downstream region at tRNA end position |
tttttgaagc |
Secondary structure (Cloverleaf model) | >W1711190269 Trp CCA t GCCA tttttgaagc G + T C - G C - G G - C G - C C - G A - T T G T G T G C C A T A A A | + | | | G T C T C G C G C G G C G | | | | T T G G A G C T A G ATGTT C - G C - G T - A G - C C - G C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |