| Sequence ID | >W1711190278 |
| Genome ID | LWRY01000155 |
| Phylum/Class | Acidithiobacillia |
| Species | Acidithiobacillus thiooxidans [LWRY] |
| Start position on genome | 6203 |
| End posion on genome | 6128 |
| Amino Acid | Thr |
| Anticodon | TGT |
| Upstream region at tRNA start position |
gcaccaattt |
| tRNA gene sequence |
GCCGGTTTAGCTCAGAGGTCAGAGCGTCCGCTTTGTAAGCGGAGGGTCGTCGGTTCGACT |
| Downstream region at tRNA end position |
acccccactg |
| Secondary structure (Cloverleaf model) | >W1711190278 Thr TGT
t TCCA acccccactg
G - C
C - G
C - G
G - C
G + T
T - A
T - A T C
T C A G C C A
A G A A | | | | | G
G C T C G G T C G G C
G | | | | T T
T G A G C
C A G GGGTC
T - A
C - G
C - G
G - C
C - G
T A
T A
T G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |