| Sequence ID | >W1711190383 |
| Genome ID | LWRZ01000283 |
| Phylum/Class | Acidithiobacillia |
| Species | Acidithiobacillus thiooxidans [LWRZ] |
| Start position on genome | 5475 |
| End posion on genome | 5550 |
| Amino Acid | Thr |
| Anticodon | CGT |
| Upstream region at tRNA start position |
tcgcgcccac |
| tRNA gene sequence |
GCCGTTGTAGCTCAGTCGGTAGAGCAACTGATTCGTAATCAGTAGGTCAGAGGTTCGATT |
| Downstream region at tRNA end position |
tataaaacaa |
| Secondary structure (Cloverleaf model) | >W1711190383 Thr CGT
c ACCA tataaaacaa
G - C
C - G
C - G
G - C
T - A
T - A
G - C T T
T T C C C C A
T G A A | | | | G
C C T C G A G A G G C
G | | | | T T
G G A G C
T A A AGGTC
A - T
C - G
T - A
G - C
A - T
T A
T A
C G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |