| Sequence ID | >W1711190515 |
| Genome ID | LWSB01000089 |
| Phylum/Class | Acidithiobacillia |
| Species | Acidithiobacillus thiooxidans [LWSB] |
| Start position on genome | 3103 |
| End posion on genome | 3178 |
| Amino Acid | Thr |
| Anticodon | TGT |
| Upstream region at tRNA start position |
cccacttaac |
| tRNA gene sequence |
GCCGACTTAGCTCAGACGGTAGAGCGCCTGTCTTGTAAGCAGGATGTCGCCGGTTCAATT |
| Downstream region at tRNA end position |
atttgtcgat |
| Secondary structure (Cloverleaf model) | >W1711190515 Thr TGT
c TCCA atttgtcgat
G - C
C - G
C - G
G - C
A - T
C - G
T - A T T
T C G G C C A
A G A A | | | | | A
C C T C G G C C G G C
G | | | | T T
G G A G C
T A G ATGTC
C - G
C - G
T - A
G - C
T + G
C A
T A
T G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |