| Sequence ID | >W1711190541 |
| Genome ID | LWSB01000182 |
| Phylum/Class | Acidithiobacillia |
| Species | Acidithiobacillus thiooxidans [LWSB] |
| Start position on genome | 8931 |
| End posion on genome | 8856 |
| Amino Acid | Asn |
| Anticodon | GTT |
| Upstream region at tRNA start position |
ccgggcattt |
| tRNA gene sequence |
TGGGGTGTAGCTCAGTAGGTAGAGCGTCCGGCTGTTAACCAGAATGTCGCAGGTTCGAGC |
| Downstream region at tRNA end position |
atcgcttgag |
| Secondary structure (Cloverleaf model) | >W1711190541 Asn GTT
t GCCA atcgcttgag
T - A
G - C
G - C
G - C
G - C
T + G
G - C C G
T C G T C C A
T G A A | | | | | G
A C T C G G C A G G C
G | | | | T T
G G A G C
T A G ATGTC
T - A
C - G
C A
G - C
G - C
C A
T A
G T T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |