| Sequence ID | >W1711190557 |
| Genome ID | LWSB01000182 |
| Phylum/Class | Acidithiobacillia |
| Species | Acidithiobacillus thiooxidans [LWSB] |
| Start position on genome | 6311 |
| End posion on genome | 6237 |
| Amino Acid | Glu |
| Anticodon | CTC |
| Upstream region at tRNA start position |
gcaccaacac |
| tRNA gene sequence |
GCTTCTATCGGCTATCGGTCAGGCCCCAAGGTTCTCAACCTTGTGAGGCGGGTTCGACTC |
| Downstream region at tRNA end position |
aaccatgctc |
| Secondary structure (Cloverleaf model) | >W1711190557 Glu CTC
c ACCA aaccatgctc
G - C
C - G
T - A
T + G
C - G
T + G
A - T T C
T C G C C C A
C T A C | | | | | G
G T C G G G C G G G C
G + | | | T T
T G G C C
C A C TGAG
C - G
A - T
A - T
G - C
G - C
T A
T A
C T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |