Sequence ID | >W1711190587 |
Genome ID | LWSC01000033 |
Search identical group | |
Phylum/Class | Acidithiobacillia |
Species | Acidithiobacillus thiooxidans [LWSC] |
Start position on genome | 8572 |
End posion on genome | 8483 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ccactgtcac |
tRNA gene sequence |
GGAGGTGTGGCAGAGCGGTTGAATGCACCGGTCTTGAAAACCGGCAGGGGTTTGCGCCCC |
Downstream region at tRNA end position |
ataaactatc |
Secondary structure (Cloverleaf model) | >W1711190587 Ser TGA c GCCA ataaactatc G - C G - C A - T G - C G - C T + G G - C T A T C A C T C A C G A G | | | | | G G G A C G G T G A G C G | | | T T T A T G C T G A A CAGGGGTTTGCGCCCCTC C - G C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |