| Sequence ID | >W1711190600 |
| Genome ID | LWSC01000048 |
| Phylum/Class | Acidithiobacillia |
| Species | Acidithiobacillus thiooxidans [LWSC] |
| Start position on genome | 13025 |
| End posion on genome | 12951 |
| Amino Acid | Phe |
| Anticodon | AAA |
| Upstream region at tRNA start position |
gccaattttt |
| tRNA gene sequence |
GCACGATAGTCTGATGTGGTGAGGTGGTAGGTTAAAAACCTGCTTAGGTCGGTTCGATTC |
| Downstream region at tRNA end position |
ttttggaact |
| Secondary structure (Cloverleaf model) | >W1711190600 Phe AAA
t TCCA ttttggaact
G - C
C - G
A - T
C - G
G - C
A - T
T - A T T
A C G G C C A
G T A G | + | | | G
T G T C T G T C G G C
G + | T T
G A G G T
T G G TTAG
G - C
T + G
A - T
G - C
G - C
T A
T A
A A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |