Sequence ID | >W1711196527 |
Genome ID | LWWW01000134 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Burkholderia pseudomallei [LWWW] |
Start position on genome | 38024 |
End posion on genome | 38099 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
ctgttggtga |
tRNA gene sequence |
GGGGCGGTAGCTCAGCTGGGAGAGCGTCGCGTTCGCAATGCGAAGGTCGGGAGTTCGATC |
Downstream region at tRNA end position |
agaataatcg |
Secondary structure (Cloverleaf model) | >W1711196527 Ala CGC a ACCA agaataatcg G - C G - C G + T G - C C - G G - C G - C C T T T C C T C A C G A A + | | | | G T C T C G G G G A G C G | | | | T T G G A G C G A G AGGTC T - A C - G G - C C - G G + T T A T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |