Sequence ID | >W1711205560 |
Genome ID | LXDM01000232 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Burkholderia pseudomallei [LXDM] |
Start position on genome | 3821 |
End posion on genome | 3745 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
acagactcag |
tRNA gene sequence |
GGGTCTGTAGCTCAGTCGGTTAGAGCACCGTCTTGATAAGGCGGGGGTCGTTGGTTCGAA |
Downstream region at tRNA end position |
attgtctggc |
Secondary structure (Cloverleaf model) | >W1711205560 Ile GAT g ACCA attgtctggc G - C G - C G - C T - A C - G T - A G - C T A T C A A C C A T G A A | | | | | G C C T C G G T T G G C G | | | | T T G G A G C T T A A GGGTC C - G C - G G - C T + G C - G T A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |