Sequence ID | >W1711206675 |
Genome ID | LXEI01000014 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Tamlana agarivorans [LXEI] |
Start position on genome | 13528 |
End posion on genome | 13451 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
tgatttatat |
tRNA gene sequence |
CGGGATGTGGCGCAGTCCGGTTAGCGTACACGGCTGGGGGCCGTGTGGTCGCAGGTTCAA |
Downstream region at tRNA end position |
aaaccgattt |
Secondary structure (Cloverleaf model) | >W1711206675 Pro GGG t ACAA aaaccgattt C - G G - C G - C G - C A - T T - A G - C T A T T G T C C A C T G A G + | | | | A C C G C G G C A G G C G | | | + T T G G C G T T T A A TGGTC C - G A - T C - G G - C G - C C G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |