Sequence ID | >W1711209627 |
Genome ID | LXHK01000012 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Moraxella catarrhalis [LXHK] |
Start position on genome | 207510 |
End posion on genome | 207596 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
aacaatacat |
tRNA gene sequence |
GCCAGTGTGGTGAAATTGGTAGACACGACGGATTCAAAATCCGTTGCCCTTAAAAGCGTG |
Downstream region at tRNA end position |
ataaaatcaa |
Secondary structure (Cloverleaf model) | >W1711209627 Leu CAA t ACCA ataaaatcaa G + T C - G C - G A - T G - C T - A G - C T G T C A G C C A T A A G | | | | | G T A G T G G T C G G C G | | | T T G A C A C T A G G TGCCCTTAAAAGCGT A - T C - G G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |