Sequence ID | >W1711214015 |
Genome ID | LXKU01000020 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Agrobacterium rubi [LXKU] |
Start position on genome | 473043 |
End posion on genome | 473118 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
cgcttggcaa |
tRNA gene sequence |
GCCGCTTTAGCTCAGGTGGTAGAGCACATCATTCGTAATGATGGGGTCGCAGGTTCGAGT |
Downstream region at tRNA end position |
gtcttggtga |
Secondary structure (Cloverleaf model) | >W1711214015 Thr CGT a ACCA gtcttggtga G - C C - G C - G G - C C - G T - A T - A T G T C G T C C A G G A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C T A A GGGTC C - G A - T T - A C - G A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |