Sequence ID | >W131193066 |
Genome ID | ASNM01000064 |
Search identical group | |
Phylum/Class | Unclassified |
Species | Cloacimonetes bacterium SCGC AAA252-G08 KSB1 bacterium SCGC AAA252-G08 [ASNM] |
Start position on genome | 10240 |
End posion on genome | 10317 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
tgctctcagt |
tRNA gene sequence |
CGGGGCGTAGCGCAGCCCGGTTAGCGCGCCTGGTTTGGGACCAGGAGGTCGGAAGTTCGA |
Downstream region at tRNA end position |
cttataaaat |
Secondary structure (Cloverleaf model) | >W131193066 Pro TGG t ACCA cttataaaat C - G G - C G - C G - C G - C C - G G - C T A T T C T T C A C C G A A + | | | | G C C G C G G G A A G C G | | | | T T G G C G C T T A G AGGTC C - G C - G T - A G - C G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |