Sequence ID | >W131193183 |
Genome ID | ASNT01000007 |
Search identical group | |
Phylum/Class | Unclassified |
Species | Cloacimonetes bacterium SCGC AAA252-P10 KSB1 bacterium SCGC AAA252-P10 [ASNT] |
Start position on genome | 432 |
End posion on genome | 508 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
accataactt |
tRNA gene sequence |
GCGGGAATAGCTCAGCTGGCTAGAGCATTAGCCTTCCAAGCTAAGGGTCGCGGGTTCGAA |
Downstream region at tRNA end position |
tgctcgtgta |
Secondary structure (Cloverleaf model) | >W131193183 Gly TCC t TCCA tgctcgtgta G - C C - G G - C G - C G - C A - T A - T C A T T G C C C A C G A A + | | | | G T C T C G G C G G G C G | | | | T T G G A G C C T A A GGGTC T - A T - A A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |