| Sequence ID | >W1711223927 |
| Genome ID | LXTQ01000030 |
| Phylum/Class | Betaproteobacteria |
| Species | Methylobacillus sp. MM3 MM2 [LXTQ] |
| Start position on genome | 163077 |
| End posion on genome | 163163 |
| Amino Acid | Leu |
| Anticodon | CAA |
| Upstream region at tRNA start position |
ggtcccacaa |
| tRNA gene sequence |
GCCGGGATGGCGGAATCGGTAGACGCAGCGGATTCAAAATCCGCCGCTGGTAACAGTGTG |
| Downstream region at tRNA end position |
aattttctca |
| Secondary structure (Cloverleaf model) | >W1711223927 Leu CAA
a ACCA aattttctca
G - C
C - G
C - G
G - C
G - C
G - C
A - T T G
T C C C C C A
T A A G | | | | | G
C G G C G G G G G G C
G | | | T T
G A C G C
T A G A CGCTGGTAACAGTGT
G - C
C - G
G - C
G - C
A - T
T A
T A
C A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |