Sequence ID | >W1711229461 |
Genome ID | LXYL01000011 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Erythrobacter sp. EhN03 [LXYL] |
Start position on genome | 43322 |
End posion on genome | 43233 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
ccgacaatgc |
tRNA gene sequence |
GGAGAGGTGGCAGAGAGGTCGAATGCGCCGCACTCGAAATGCGGTATACGGGCAACCGTA |
Downstream region at tRNA end position |
cgggcttttc |
Secondary structure (Cloverleaf model) | >W1711229461 Ser CGA c GCCA cgggcttttc G - C G - C A - T G - C A - T G - C G - C T A T C A C C C A A G A G | | | | | G G G A C G G T G G G C G | | | T T T A T G C C G A G TATACGGGCAACCGTATC C - G C - G G - C C - G A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |