Sequence ID | >W1711247465 |
Genome ID | LYKE01000001 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Acinetobacter nosocomialis [LYKE] |
Start position on genome | 102371 |
End posion on genome | 102447 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cttatttata |
tRNA gene sequence |
GGGCCTATAGCTCAGTTGGTTAGAGCAGCGGACTCATAATCCGTTGGTCCACAGTTCAAG |
Downstream region at tRNA end position |
aatacaaacc |
Secondary structure (Cloverleaf model) | >W1711247465 Met CAT a ACCA aatacaaacc G - C G - C G - C C - G C - G T + G A - T T G T G T G T C A T G A A | | | | | A T C T C G C A C A G C G | | | | T T G G A G C T T A A TGGTC G + T C - G G - C G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |