Sequence ID | >W1711252838 |
Genome ID | LYPG01000066 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Rhodococcus erythropolis [LYPG] |
Start position on genome | 134681 |
End posion on genome | 134767 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
tcggggccga |
tRNA gene sequence |
GTCCGAGTGGCGGAATGGCAGACGCGCTAGCTTGAGGTGCTAGTGTCCTATTAACGGACG |
Downstream region at tRNA end position |
tgtgttgaga |
Secondary structure (Cloverleaf model) | >W1711252838 Leu GAG a ACtc tgtgttgaga G - C T - A C - G C - G G - C A - T G - C T G T C C C C C A T A A G | | | | | A G G G C G G G G G G C G | | | T T C A C G C A G G TGTCCTATTAACGGACGT C - G T - A A - T G - C C - G T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |