Sequence ID | >W131214207 |
Genome ID | ATTQ01000002 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Rhizobium mongolense USDA 1844 [ATTQ] |
Start position on genome | 450423 |
End posion on genome | 450496 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
ttccgtgatc |
tRNA gene sequence |
GCGGGTGTAGCTCAATGGTAGAGCAGCAGCTTCCCAAGCTGAATACGAGGGTTCGATTCC |
Downstream region at tRNA end position |
actgcccttt |
Secondary structure (Cloverleaf model) | >W131214207 Gly CCC c TCCA actgcccttt G - C C - G G - C G - C G - C T - A G - C T T T T T C C C A A A A + | | | | G T C T C G G A G G G C G | | | | T T G G A G C T A A ATAC G A C - G A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |