Sequence ID | >W131215397 |
Genome ID | ATUZ01000011 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Desulfovibrio desulfuricans subsp. desulfuricans DSM 642 [ATUZ] |
Start position on genome | 716513 |
End posion on genome | 716589 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
cttgtcatgt |
tRNA gene sequence |
GCGCCCGTAGCTCAGTTGGATAGAGCAGGAACCTTCTAAGTTCTTGGTCAGGGGTTCGAT |
Downstream region at tRNA end position |
ataaaatcaa |
Secondary structure (Cloverleaf model) | >W131215397 Arg TCT t GCCA ataaaatcaa G - C C - G G - C C - G C - G C - G G - C T T T T C T C C A T G A A | | + | | G T C T C G A G G G G C G | | | | T T G G A G C A T A A TGGTC G + T G - C A - T A - T C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |