Sequence ID | >W1711285130 |
Genome ID | LZSB01000083 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Klebsiella pneumoniae [LZSB] |
Start position on genome | 346 |
End posion on genome | 270 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
taatctctgc |
tRNA gene sequence |
AGGCTTGTAGCTCAGGTGGTTAGAGCGCACCCCTGATAAGGGTGAGGTCGGTGGTTCAAG |
Downstream region at tRNA end position |
aatttgcgaa |
Secondary structure (Cloverleaf model) | >W1711285130 Ile GAT c ACCA aatttgcgaa A - T G - C G - C C - G T + G T - A G - C T G T T C A C C A G G A A + | | | | A T C T C G G G T G G C G | | | | T T G G A G C T T A G AGGTC C - G A - T C - G C - G C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |