Sequence ID | >W131218450 |
Genome ID | ATXT01000003 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Humibacter albus DSM 18994 [ATXT] |
Start position on genome | 54884 |
End posion on genome | 54959 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
gacgaatcat |
tRNA gene sequence |
GCACCTCTAGCTCAATCGGCAGAGCAACTGACTCTTAATCAGTGGGTTCAGGGTTCAAGT |
Downstream region at tRNA end position |
cacttcccct |
Secondary structure (Cloverleaf model) | >W131218450 Lys CTT t ACCA cacttcccct G - C C - G A - T C - G C - G T + G C - G T G T G T C C C A T A A A | | | | | A C C T C G C A G G G C G | | | | T T G G A G C C A A GGGTT A - T C - G T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |