Sequence ID | >W131218480 |
Genome ID | ATXT01000015 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Humibacter albus DSM 18994 [ATXT] |
Start position on genome | 22695 |
End posion on genome | 22621 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
tgaacggcca |
tRNA gene sequence |
GCCTCTGTAGCTCAATGGAAGAGCAGTTCCGTCCTAAGGAAACGGTTGGGGGTTCGAGTC |
Downstream region at tRNA end position |
agtgttttgt |
Secondary structure (Cloverleaf model) | >W131218480 Arg CCT a ACCA agtgttttgt G - C C - G C - G T + G C - G T - A G - C T G T C T C C C A A A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C A A A CGGTT G A T - A T - A C - G C - G G A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |