Sequence ID | >W131218984 |
Genome ID | ATYE01000003 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Asinibacterium sp. OR43 OR43 [ATYE] |
Start position on genome | 77222 |
End posion on genome | 77297 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
acaacaaaaa |
tRNA gene sequence |
GGGAGCATAGCTCAGCTGGTTTAGAGCATCTGCCTTACAAGCAGAGGGTCCGCGGTTCGA |
Downstream region at tRNA end position |
aatgaagaaa |
Secondary structure (Cloverleaf model) | >W131218984 Val TAC a ACtc aatgaagaaa G - C G - C G - C A - T G - C C - G A - T C A T G T G C C A T C G A A | + | | | G G C T C G C G C G G C G | | | | T T T G A G C T T A A GGGTC T - A C - G T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |