| Sequence ID | >W1711292998 |
| Genome ID | LZYF01000026 |
| Phylum/Class | Acidithiobacillia |
| Species | Acidithiobacillus caldus [LZYF] |
| Start position on genome | 18316 |
| End posion on genome | 18241 |
| Amino Acid | Thr |
| Anticodon | GGT |
| Upstream region at tRNA start position |
ccaagtacag |
| tRNA gene sequence |
GCCCACATAGCTCAGTCGGCAGAGCACTTCCTTGGTAAGGAAGAGGTCACCGGTTCGAAT |
| Downstream region at tRNA end position |
ttttcgttga |
| Secondary structure (Cloverleaf model) | >W1711292998 Thr GGT
g TCCA ttttcgttga
G - C
C - G
C - G
C - G
A - T
C - G
A - T T A
T T G G C C A
T G A A | | | | | G
C C T C G A C C G G C
G | | | | T T
G G A G C
C A A AGGTC
C - G
T - A
T - A
C - G
C - G
T A
T A
G G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |