| Sequence ID | >W1711293194 |
| Genome ID | LZYI01000116 |
| Phylum/Class | Acidithiobacillia |
| Species | Acidithiobacillus thiooxidans [LZYI] |
| Start position on genome | 4927 |
| End posion on genome | 4851 |
| Amino Acid | Arg |
| Anticodon | TCG |
| Upstream region at tRNA start position |
atctcccctt |
| tRNA gene sequence |
GCCCCTTTAGCTCAGTGGACCAGAGCATCCGGCTTCGAACCGGATGGTCGGGAGTTCGAA |
| Downstream region at tRNA end position |
tgcggttgta |
| Secondary structure (Cloverleaf model) | >W1711293194 Arg TCG
t ACCA tgcggttgta
G - C
C - G
C - G
C A
C - G
T - A
T - A C A
T C C T T C A
T G A A | | + | | G
G C T C G G G G A G C
G | | | | T T
A G A G C
C C A A TGGTC
T - A
C - G
C - G
G - C
G - C
C A
T A
T C G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |