Sequence ID | >W1711300601 |
Genome ID | MAHC01000017 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Elizabethkingia meningoseptica [MAHC] |
Start position on genome | 16747 |
End posion on genome | 16672 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aaagatacat |
tRNA gene sequence |
CGCGGGGTGGAGCAGTAGGTAGCTCGTCGGGCTCATAACCCGAAGGTCGCACGTTCGAGT |
Downstream region at tRNA end position |
aaaggagaat |
Secondary structure (Cloverleaf model) | >W1711300601 Met CAT t ACTA aaaggagaat C T G - C C - G G - C G - C G - C G - C T G T T G T G C A T G A G + | | | | G A C G A G G C A C G C G | | | | T T G G C T C T A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |