Sequence ID | >W1711312060 |
Genome ID | MASI01000001 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Methyloligella halotolerans [MASI] |
Start position on genome | 784108 |
End posion on genome | 784033 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
gatgccggtc |
tRNA gene sequence |
GGGCGCATAGCTCAGTTGGTAGAGCAGCTGACTCTTAATCAGCGGGTCCAAGGTTCGAAT |
Downstream region at tRNA end position |
aatttccttt |
Secondary structure (Cloverleaf model) | >W1711312060 Lys CTT c ACCA aatttccttt G - C G - C G - C C - G G - C C - G A - T T A T G T T C C A T G A A | | | | | G T C T C G C A A G G C G | | | | T T G G A G C T A A GGGTC G - C C - G T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |