| Sequence ID | >W1711312163 |
| Genome ID | MASQ01000081 |
| Phylum/Class | Acidithiobacillia |
| Species | Acidithiobacillus ferrivorans [MASQ] |
| Start position on genome | 14536 |
| End posion on genome | 14609 |
| Amino Acid | Gln |
| Anticodon | CTG |
| Upstream region at tRNA start position |
gcccctctct |
| tRNA gene sequence |
TGGGGGATCGTCTAGCGGTAGGACAGCGGACTCTGACTCCGCTAACCGTGGTTCGAATCC |
| Downstream region at tRNA end position |
ataaaaacaa |
| Secondary structure (Cloverleaf model) | >W1711312163 Gln CTG
t GCCA ataaaaacaa
T - A
G - C
G - C
G - C
G - C
G - C
A - T T A
T G C A C C A
G A C | | | | | G
C T C T G C G T G G C
G + | | | T T
G G G A C
T A A TAAC
G - C
C - G
G - C
G - C
A - T
C C
T A
C T G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |