Sequence ID | >W131224537 |
Genome ID | AUCW01000020 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Desulfogranum mediterraneum DSM 13871 [AUCW] |
Start position on genome | 75855 |
End posion on genome | 75758 |
Amino Acid | SeC(p) |
Anticodon | TCA |
Upstream region at tRNA start position |
atgcaaaagg |
tRNA gene sequence |
GGAAGTGGAAAGGGCACTGGTGGCCCTCCCGGACTTCAAATCCGGTGTGACGGGTGAACA |
Downstream region at tRNA end position |
ttcattctaa |
Secondary structure (Cloverleaf model) | >W131224537 SeC(p) TCA g GCCA ttcattctaa G - C G - C A - T A - T G - C T - A G - C G G T T A T A C C C A C A C A + | | | | G T G G G A G T G G G C G | | | | T T G C C C T T G G C TGTGACGGGTGAACAGCCTGTCAG C - G C - G G - C G - C A - T C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |