Sequence ID | >W1711313996 |
Genome ID | MAUD01000090 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Streptomyces lushanensis [MAUD] |
Start position on genome | 10402 |
End posion on genome | 10316 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
cacacccaat |
tRNA gene sequence |
GCGCGGGTGGCGGAATAGGCAGACGCGCTGGATTCAGGTTCCAGTGCCCGAAAGGGCGTG |
Downstream region at tRNA end position |
cagaaccccc |
Secondary structure (Cloverleaf model) | >W1711313996 Leu CAG t ACCA cagaaccccc G - C C - G G - C C - G G - C G + T G - C T C T C C C C C A T A A G | | | | | A A G G C G G G G G G C G | | | T T G A C G C C A G G TGCCCGAAAGGGCGT C - G T - A G - C G - C A - T T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |