Sequence ID | >W1711317556 |
Genome ID | MAXJ01000538 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Desulfobacterales bacterium S5133MH4 [MAXJ] |
Start position on genome | 7113 |
End posion on genome | 7187 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
atgaaggtgt |
tRNA gene sequence |
TGGGGTGTCGTCAAGTGGTAAGACACAGGATTTTGGTTCCTGCATTCGGAGGTTCGAATC |
Downstream region at tRNA end position |
ttttcaccaa |
Secondary structure (Cloverleaf model) | >W1711317556 Gln TTG t GCCA ttttcaccaa T - A G - C G - C G - C G - C T - A G - C T A T C C T C C A G A C | | | | | G T A C T G G G A G G C G | | | T T G A G A C T A A CATTC C - G A - T G - C G - C A - T T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |