Sequence ID | >W1711317825 |
Genome ID | MAXT01000242 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Desulfuromonadales bacterium C00003107 [MAXT] |
Start position on genome | 3443 |
End posion on genome | 3518 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
agcttttatg |
tRNA gene sequence |
GTGGGTGTAGCTCAGTCGGTAGAGCACTGGATTGTGGCTCCAGTTGTCGAGGGTTCGATC |
Downstream region at tRNA end position |
ttttacaacc |
Secondary structure (Cloverleaf model) | >W1711317825 His GTG g CCCA ttttacaacc G - C T - A G - C G + T G - C T - A G - C C T T T T C C C A T G A A + | | | | G C C T C G G A G G G C G | | | | T T G G A G C T A A TTGTC C - G T - A G - C G - C A - T T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |