Sequence ID | >W131227176 |
Genome ID | AUEY01000057 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Desulforegula conservatrix Mb1Pa [AUEY] |
Start position on genome | 949 |
End posion on genome | 873 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
atctttctaa |
tRNA gene sequence |
GCGCCTGTAGCTCAGCTGGACAGAGCAACGGACTTCTAATCCGTGGGTCAGGGGTTCGAA |
Downstream region at tRNA end position |
tttaaaatta |
Secondary structure (Cloverleaf model) | >W131227176 Arg TCT a GCCA tttaaaatta G + T C - G G - C C - G C - G T - A G - C T A T T T C C C A C G A A | + | | | G T C T C G A G G G G C G | | | | T T G G A G C A C A A GGGTC A - T C - G G - C G - C A - T C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |