Sequence ID | >W131229841 |
Genome ID | AUHC01000002 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Erythrobacter cryptus DSM 12079 [AUHC] |
Start position on genome | 376074 |
End posion on genome | 376164 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
ggggggctgc |
tRNA gene sequence |
GGAGCAGTGGCCGAGTGGTCGAAGGCGCACGCCTGGAAAGTGTGTATACGGCAAAACCGT |
Downstream region at tRNA end position |
cttgccctcg |
Secondary structure (Cloverleaf model) | >W131229841 Ser GGA c GCCA cttgccctcg G - C G - C A - T G - C C - G A - T G - C T A T C T C C C A T G A G | | | | | G G G C C G G A G G G C G | | | T T T A G G C C G A G TATACGGCAAAACCGTATC C - G A - T C - G G + T C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |