Sequence ID | >W1711335746 |
Genome ID | MBRD01000004 |
Search identical group | |
Phylum/Class | Cyanobacteriota |
Species | Nostoc sp. MBR 210 [MBRD] |
Start position on genome | 166241 |
End posion on genome | 166313 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
tatttagtgg |
tRNA gene sequence |
GGGTGACTAGCTCAACGGTAGAGCAGTAGACTCTTAATCTATTGGTTGCGGGTTCAAATC |
Downstream region at tRNA end position |
ctttgagaat |
Secondary structure (Cloverleaf model) | >W1711335746 Lys CTT g ACtg ctttgagaat G - C G - C G - C T - A G - C A - T C - G T A T C T C C C A A A A | | | | A C C T C G G C G G G C G | | | | T T G G A G C T A A TGGTT G + T T - A A - T G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |