Sequence ID | >W1711339144 |
Genome ID | MCAC01000038 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Neisseria meningitidis [MCAC] |
Start position on genome | 38960 |
End posion on genome | 39036 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ttcacgaaac |
tRNA gene sequence |
GGCGAATTAGCTCAGTCGGTTAGAGCAGAGGAATCATAATCCTTGTGTCCGGGGTTCGAA |
Downstream region at tRNA end position |
aattttcggg |
Secondary structure (Cloverleaf model) | >W1711339144 Met CAT c ACCA aattttcggg G - C G - C C - G G - C A - T A - T T - A T A T G T C C C A T G A A | + | | | G C C T C G C G G G G C G | | | | T T G G A G C T T A A GTGTC G + T A - T G - C G - C A - T A A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |