Sequence ID | >W131231762 |
Genome ID | AUIS01000004 |
Search identical group | |
Phylum/Class | Acidithiobacillia |
Species | Thermithiobacillus tepidarius DSM 3134 [AUIS] |
Start position on genome | 55627 |
End posion on genome | 55711 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
gccatctctc |
tRNA gene sequence |
GCGAAAGTGGCGGAATTGGTAGACGCACTGGATTTAGGTTCCAGCGCCGCAAGGCATGCG |
Downstream region at tRNA end position |
tctcacgctg |
Secondary structure (Cloverleaf model) | >W131231762 Leu TAG c ACCA tctcacgctg G - C C - G G - C A - T A - T A - T G - C T G T C G C C C A T A A G | | | | | G T G G C G G C G G G C G | | | T T G A C G C T A G A CGCCGCAAGGCAT C - G T - A G - C G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |