| Sequence ID | >W131231781 |
| Genome ID | AUIS01000017 |
| Phylum/Class | Acidithiobacillia |
| Species | Thermithiobacillus tepidarius DSM 3134 [AUIS] |
| Start position on genome | 48088 |
| End posion on genome | 48178 |
| Amino Acid | Ser |
| Anticodon | TGA |
| Upstream region at tRNA start position |
accaaagcac |
| tRNA gene sequence |
GGAGAGGTGGCAGAGCGGTTGATTGCGGCGGTCTTGAAAACCGTTGACGGCTGATACCCG |
| Downstream region at tRNA end position |
acccaggcat |
| Secondary structure (Cloverleaf model) | >W131231781 Ser TGA
c GCCA acccaggcat
G - C
G - C
A - T
G - C
A - T
G - C
G - C T A
T C A C C C A
C G A G | | | | | G
G G A C G G T G G G C
G + | | | T T
T T T G C
T G A G TGACGGCTGATACCCGTCC
G + T
C - G
G - C
G - C
T - A
C A
T A
T G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |