Sequence ID | >W131231823 |
Genome ID | AUIT01000015 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Thermodesulfobacterium hveragerdense DSM 12571 [AUIT] |
Start position on genome | 9327 |
End posion on genome | 9253 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
ttgattaagt |
tRNA gene sequence |
GCCCCTGTAGCTCAACAGGATAGAGCAGCGGCCTTCTAAGCCGTAGGTTGGGGGTTCGAG |
Downstream region at tRNA end position |
tttttatctt |
Secondary structure (Cloverleaf model) | >W131231823 Arg TCT t GCtt tttttatctt G - C C - G C - G C - G C - G T + G G - C T G T C T C C C A C A A A | + | | | G A C T C G G G G G G C G | | | | T T G G A G C A T A A AGGTT G + T C - G G - C G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |