Sequence ID | >W1711344617 |
Genome ID | MCJH01000003 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Elizabethkingia meningoseptica [MCJH] |
Start position on genome | 682968 |
End posion on genome | 682895 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
agtacaatat |
tRNA gene sequence |
CGCGGGGTGGAGCAGTAGGTAGCTCGTCGGGCTCATAACCCGAAGGTCGCACGTTCGAGT |
Downstream region at tRNA end position |
aagcaaaaga |
Secondary structure (Cloverleaf model) | >W1711344617 Met CAT t ACtg aagcaaaaga C T G - C C - G G - C G - C G - C G - C T G T T G T G C A T G A G + | | | | G A C G A G G C A C G C G | | | | T T G G C T C T A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |