Sequence ID | >W131234504 |
Genome ID | AUKV01000002 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Streptomyces sp. 142MFCol3.1 [AUKV] |
Start position on genome | 301213 |
End posion on genome | 301286 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
ggcgtcttac |
tRNA gene sequence |
GCGGGTGTAGTTTAATGGTAGAACATCAGCTTCCCAAGCTGAGAGCGCGAGTTCGATTCT |
Downstream region at tRNA end position |
tggagaaggc |
Secondary structure (Cloverleaf model) | >W131234504 Gly CCC c TCCA tggagaaggc G - C C - G G - C G - C G - C T - A G - C T T T T G C T C A A A A + | | | | G T T T T G G C G A G C G + | | | T T G G A A C T A A GAGC T - A C - G A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |