Sequence ID | >W1711361621 |
Genome ID | MDLH01000001 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Mesorhizobium sp. SEMIA 3007 [MDLH] |
Start position on genome | 1695620 |
End posion on genome | 1695545 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
ggcctcccgg |
tRNA gene sequence |
GCCGCTTTAGCTCAGTTGGTAGAGCACATCATTCGTAATGATGGGGTCAGGTGTTCGAGT |
Downstream region at tRNA end position |
gttccttgtc |
Secondary structure (Cloverleaf model) | >W1711361621 Thr CGT g ACCA gttccttgtc G - C C - G C - G G - C C - G T - A T - A T G T T C C A C A T G A A | | | | | G T C T C G A G G T G C G | | | | T T G G A G C T A A GGGTC C - G A - T T - A C - G A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |