| Sequence ID | >W1711374991 |
| Genome ID | MDWS01000003 |
| Phylum/Class | Gammaproteobacteria |
| Species | Vibrio parahaemolyticus [MDWS] |
| Start position on genome | 3603 |
| End posion on genome | 3679 |
| Amino Acid | Asp |
| Anticodon | GTC |
| Upstream region at tRNA start position |
ggctttaatc |
| tRNA gene sequence |
GGAGCGGTAGTTCAGTTGGTTAGAATACCGGCCTGTCACGCCGGGGGTCGCGGGTTCGAG |
| Downstream region at tRNA end position |
cttatttgaa |
| Secondary structure (Cloverleaf model) | >W1711374991 Asp GTC
c GCCA cttatttgaa
G - C
G - C
A - T
G - C
C - G
G - C
G - C T G
T T G C C C A
T G A A + | | | | G
T C T T G G C G G G C
G | | | + T T
G G A A T
T T A A GGGTC
C - G
C - G
G - C
G - C
C - G
C C
T A
G T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |