Sequence ID | >W131027419 |
Genome ID | AJAI01000012 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Enterococcus hirae ATCC 9790 [AJAI] |
Start position on genome | 453976 |
End posion on genome | 453883 |
Amino Acid | SeC(p) |
Anticodon | TCA |
Upstream region at tRNA start position |
gtttttatta |
tRNA gene sequence |
GGGGAGTGGATGGGTTCTGGTGTTCCCTCTGGTCTTCAAAACCAGTATGAGGAGTTAAGA |
Downstream region at tRNA end position |
aattgaatac |
Secondary structure (Cloverleaf model) | >W131027419 SeC(p) TCA a Cgcc aattgaatac G - C G - C G + T G + T A A G - C T - A T T G C A T C C A C T T G G | | | | | G T G G T A G T A G G C G + | T T G T C C C T G T T TATGAGGAGTTAAGAGCTTCTTGG C - G T - A G - C G - C T - A C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |